Wild type human von Willebrand factor cDNA: Von Willebrand factor cDNA was cloned from the Marathon-ready human bone marrow cDNA library (Clontech, Mountain View, CA) using the following three sets

ثبت نشده
چکیده

Methods Wild type human von Willebrand factor cDNA: Von Willebrand factor cDNA was cloned from the Marathon-ready human bone marrow cDNA library (Clontech, Mountain View, CA) using the following three sets of primers: 5'-CCATCCTAATACGACTCACTATAGGGC-3’ / 5'TCAATCTCTCCTCCCTCCACCAGGAT-3' (VWF 3-3103), 5'CTCACCTTCGACGGGCTCAAATACCTG-3' / 5'-TGGGAGCTGTCGGGGACAAGACAC-3' (VWF 2925-6712), 5'-AGCGAATCGAAGACCTCCCTACCATG-3' / 5' CCATCCTAATACGACTCACTATAGGGC-3' (VWF 5805-8815). All three PCR products were subcloned into pCR-blunt II-TOPO (Qiagen, Germantown, MD). VWF 63728815 was subcloned into pCR-blunt II-TOPO-VWF 2967-6663 after digestion by AclI and NotI. VWF 2967-8815 was then subcloned into the BamHI-NotI sites of pCMV6-XL5 (Origene, Rockville, MD). Finally VWF 3-3028 was inserted into pCMV6-XL5-VWF 2967-8815 SacI-BamHI double-digestion. Mutant human von Willebrand factor constructs: Mutant VWF/p.S1494C was created by PCR using two sets of primers: 5'AAAGATCGATCGCCCTGAAGC-3', 5'-AAAGTAGACACCTAGGGTCGAAACCCCCAAGA-3' (region 4361-4716), 5'-AAACCTAGGGCCCAAGAGGAACTGCATG-3', 5'-AATGTAGACCAGGTTGGGCGCCT-3' (region 4711-5067). Both PCR products were subcloned into pCR-bluntII-TOPO-h VWF 2925-6712 using restriction sites ClaI, AvrII and AccI. Mutant VWF/p.S1534C was created by PCR using primers: 5’-AAAGATCGATCGCCCTGAAGC-3’, 5'AAAAGTACTGCAGCACCGTGACGTGGATGCAGTC-3' (region 4361-4877). Subcloning into pCR-bluntII-TOPO-h VWF 2967-6663 was done with ClaI and ScaI. Double mutant VWF/p.S1494C-p.A1534C was created by PCR using primers: 5'CGACCCTGGGGCCCAAGAGGAACTGCATGG-3', 5'AAAAGTACTGCAGCACCGTGACGTGGATGCAGTC-3' (region 4707-4877), subcloning into pCR-bluntII-TOPO-h VWF 2967-6663 was done with PasI and ScaI. Final assembly of full-length human von Willebrand factor constructs in pCMV6-XL5VWF was done by digestion and ligation of BamHI-AclI fragments. Von Willebrand factor A2 constructs: Both pCMV6-XL5-VnSP-A2-His6 and pCMV6-XL5-VnSP-A2/p.S1494C-p.S1534CHis6 constructs contain the vitronectin signal peptide (isolated from a Clontech human bone marrow library using the forward primer 5’ATGGCACCCCTGAGACCCCTTCTCATA-3’ and reverse primers: A2/WT: 5’AAAGAATTCGCCAGAGCAACCCATGC-3’ or A2/p.S1494C-p.S1534C: 5’AAACTCGAGAGCCAGAGCAACCCATGC-3’). A2/WT-His6 insert was amplified with primers 5’-AAAGAATTCCATGGTTCTGGATGTGGCGTT-3’ and 5’AAATCAGTGATGGTGATGGTGATGAGGTCCGGAGCAGCACCTCTGCAGCAC-3’. A2/p.S1494C-p.S1534C-His6 insert was amplified with primers 5’AAACTCGAGAACTGCATGGTTCTGGATGTG-3’ and 5’AAATCAGTGATGGTGATGGTGATGAGGTCCGGAGCAGCACCTCTGCAGCAC-3’. All four PCR products were subcloned into pUC118 (Takara, Otsu, Japan). A2/WT-His6 was subcloned into pUC118-VnSP WT by HindIII-EcoRI double-digestion. A2/p.S1494Cp.S1534C-His6 was subcloned into pUC118-VnSP by HindIII-AfeI double-digestion. Subcloning of resulting VnSP-A2-His6 inserts into pCMV6-XL5 was done using restriction sites HindIII and SacI.

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Correction of bleeding symptoms in von Willebrand factor-deficient mice by liver-expressed von Willebrand factor mutants.

OBJECTIVE von Willebrand Factor (vWF) structure-function relationship has been studied only in vitro. To investigate the physiological importance of particular vWF domains, we have introduced mutations into murine vWF (mvWF) cDNA inhibiting vWF binding to glycoprotein (Gp) Ib, GpIIbIIIa, and to fibrillar collagen. METHODS AND RESULTS We delivered wild-type (WT) or mutant mvWF cDNA into vWF-de...

متن کامل

Frequency Assessment of the H817Q (2451T→A) Variant of von Willebrand Gene in Individuals without Hemorrhagic Signs

Abstract Background and Aims:‎ Von Willebrand disease is a bleeding disorder caused by quantitative or functional defects in von Willebrand factor. The disease is found in up to 1 percent of the population. The most common symptom is mucocutaneous bleeding. Recently, studies conducted on healthy people showed that the H817Q mutation that previously known to cause von Willebrand...

متن کامل

Analysis of von Willebrand factor mRNA from the lung of pigs with severe von Willebrand disease by using a human cDNA probe.

To examine the control of porcine von Willebrand factor (vWF) biosynthesis we cloned human vWF complementary DNA (cDNA) and investigated the expression of the vWF gene in lungs from normal pigs and pigs with severe von Willebrand's disease (vWD). Recombinant clones spanning approximately 90% of human vWF cDNA were identified in a lambda gt10 human lung cDNA library by screening with oligonucleo...

متن کامل

Construction of cDNA coding for human von Willebrand factor using antibody probes for colony-screening and mapping of the chromosomal gene

Von Willebrand Factor (vWF) mRNA was identified in fractionated polyA+ RNA preparations isolated from cultured human endothelial cells. Micro-injection of specific polyA+ RNA fractions in Xenopus laevis oocytes provoked the synthesis of a vWF-like product which could be detected with an immunoradiometric assay relying on Sepharose-linked monoclonal anti-vWF IgG and different radiolabeled monocl...

متن کامل

Structural analysis of recombinant von Willebrand factor: identification of hetero- and homo-dimers.

Wild-type full-length cDNA of von Willebrand factor (vWF) was expressed in CHO cells. Recombinant vWF (rvWF) was obtained and its molecular composition investigated by two-dimensional electrophoresis. Results of first dimension electrophoresis under non-reducing conditions showed that rvWF-dimer represents a mixture of three different species. Second dimension electrophoresis under reducing con...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

عنوان ژورنال:

دوره   شماره 

صفحات  -

تاریخ انتشار 2014