Wild type human von Willebrand factor cDNA: Von Willebrand factor cDNA was cloned from the Marathon-ready human bone marrow cDNA library (Clontech, Mountain View, CA) using the following three sets

Methods Wild type human von Willebrand factor cDNA: Von Willebrand factor cDNA was cloned from the Marathon-ready human bone marrow cDNA library (Clontech, Mountain View, CA) using the following three sets of primers: 5'-CCATCCTAATACGACTCACTATAGGGC-3’ / 5'TCAATCTCTCCTCCCTCCACCAGGAT-3' (VWF 3-3103), 5'CTCACCTTCGACGGGCTCAAATACCTG-3' / 5'-TGGGAGCTGTCGGGGACAAGACAC-3' (VWF 2925-6712), 5'-AGCGAATCGAAGACCTCCCTACCATG-3' / 5' CCATCCTAATACGACTCACTATAGGGC-3' (VWF 5805-8815). All three PCR products were subcloned into pCR-blunt II-TOPO (Qiagen, Germantown, MD). VWF 63728815 was subcloned into pCR-blunt II-TOPO-VWF 2967-6663 after digestion by AclI and NotI. VWF 2967-8815 was then subcloned into the BamHI-NotI sites of pCMV6-XL5 (Origene, Rockville, MD). Finally VWF 3-3028 was inserted into pCMV6-XL5-VWF 2967-8815 SacI-BamHI double-digestion. Mutant human von Willebrand factor constructs: Mutant VWF/p.S1494C was created by PCR using two sets of primers: 5'AAAGATCGATCGCCCTGAAGC-3', 5'-AAAGTAGACACCTAGGGTCGAAACCCCCAAGA-3' (region 4361-4716), 5'-AAACCTAGGGCCCAAGAGGAACTGCATG-3', 5'-AATGTAGACCAGGTTGGGCGCCT-3' (region 4711-5067). Both PCR products were subcloned into pCR-bluntII-TOPO-h VWF 2925-6712 using restriction sites ClaI, AvrII and AccI. Mutant VWF/p.S1534C was created by PCR using primers: 5’-AAAGATCGATCGCCCTGAAGC-3’, 5'AAAAGTACTGCAGCACCGTGACGTGGATGCAGTC-3' (region 4361-4877). Subcloning into pCR-bluntII-TOPO-h VWF 2967-6663 was done with ClaI and ScaI. Double mutant VWF/p.S1494C-p.A1534C was created by PCR using primers: 5'CGACCCTGGGGCCCAAGAGGAACTGCATGG-3', 5'AAAAGTACTGCAGCACCGTGACGTGGATGCAGTC-3' (region 4707-4877), subcloning into pCR-bluntII-TOPO-h VWF 2967-6663 was done with PasI and ScaI. Final assembly of full-length human von Willebrand factor constructs in pCMV6-XL5VWF was done by digestion and ligation of BamHI-AclI fragments. Von Willebrand factor A2 constructs: Both pCMV6-XL5-VnSP-A2-His6 and pCMV6-XL5-VnSP-A2/p.S1494C-p.S1534CHis6 constructs contain the vitronectin signal peptide (isolated from a Clontech human bone marrow library using the forward primer 5’ATGGCACCCCTGAGACCCCTTCTCATA-3’ and reverse primers: A2/WT: 5’AAAGAATTCGCCAGAGCAACCCATGC-3’ or A2/p.S1494C-p.S1534C: 5’AAACTCGAGAGCCAGAGCAACCCATGC-3’). A2/WT-His6 insert was amplified with primers 5’-AAAGAATTCCATGGTTCTGGATGTGGCGTT-3’ and 5’AAATCAGTGATGGTGATGGTGATGAGGTCCGGAGCAGCACCTCTGCAGCAC-3’. A2/p.S1494C-p.S1534C-His6 insert was amplified with primers 5’AAACTCGAGAACTGCATGGTTCTGGATGTG-3’ and 5’AAATCAGTGATGGTGATGGTGATGAGGTCCGGAGCAGCACCTCTGCAGCAC-3’. All four PCR products were subcloned into pUC118 (Takara, Otsu, Japan). A2/WT-His6 was subcloned into pUC118-VnSP WT by HindIII-EcoRI double-digestion. A2/p.S1494Cp.S1534C-His6 was subcloned into pUC118-VnSP by HindIII-AfeI double-digestion. Subcloning of resulting VnSP-A2-His6 inserts into pCMV6-XL5 was done using restriction sites HindIII and SacI.